Cashew nut milk is a plant-based milk that resembles animal milk in proximate composition. It is obtained from blends of processed cashew nut (Anacardium occidentale) and water. It is rich in nutrients, including fat, protein, and minerals [1]. Cashew nut milk is highly appreciated by people due to its unique taste and flavor and is increasingly used in various food recipes, including ice cream, coffee, desserts, yogurt, etc. 

Fermentation, according to Marshall and Mejia [2] and Chaves-Lopez et al. [3], is recognized as a natural way to preserve and safeguard foods and beverages, thereby enhancing the nutritional value, improving the digestibility, destroying undesirable components, and inhibiting undesirable microorganisms. In the rural areas, most foods, particularly dairy products, are produced under spontaneous conditions with uncontrolled time, temperature, pH, etc. It is traditionally believed that the inherent microflora of the food material under the fermentation process will give unique quality to the final product than when the microorganisms are imported outside the food material.

Spontaneous fermentation, otherwise known as wild fermentation, can be said to be a natural fermentation process where microorganisms from the food product or environment initiate the fermentation process without adding any commercial starter culture, yeast, or other microorganisms. Spontaneous fermentation relies on a diverse array of microorganisms, including bacteria, molds, and yeast. The types of microorganisms in spontaneous fermentation vary based on geographical location, climate, raw materials, temperature, pH, oxygen, etc. However, during spontaneous fermentation, a number of microorganisms tend to grow depending on the medium and environmental conditions. Some microorganisms tend to dominate the medium, thereby suppressing the growth of other organisms.

Microorganisms play a significant role in the fermentation of food products. N’zi et al. [4] reported that microorganisms responsible for the fermentation of any food are usually present in the fermenting medium, which may enter as the result of exposure of the food to air, water, soil, containers, etc. The microorganisms involved in natural fermentation are most often lactic acid bacteria, yeasts [4], and some opportunistic microorganisms.

Reported literature showed that Lactobacillus sanfranciscensis, Lactobacillus alimentarius, Lactobacillus buchneri, Lactobacillus casei, Lactobacillus delbrueckii, Lactobacillus fructivorans, Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus johnsonii, Candida humili, Issatchenkia orientalis, Bacillus pumilus, Bacillus licheniformis, Bacillus subtilis, Bacillus firmus, Bacillus atrophaeus, Bacillus amyloliquefaciens, Bacillus mojavensis, Bacillus sp., Lactobacillus plantarum, Leuconostoc mesenteroides, Lactobacillus cellobiosus, Lactobacillus brevis, Lactobacillus coprophilus, Lactococus lactis, Leuconostic lactis, Lactobacillus bulgaricus, Klebsiella sp., Leuconostoc sp., Corynebacterium sp., Candida sp., etc. have been involved in the fermentation of a number of food products [5, 6, 7]. These microorganisms cannot exist in isolation. They could be found in the air, water, soil, environment, utensils, raw materials/food products, food handlers, etc. They could even form part of the microflora of the fermenting material, which could be isolated and purified for use in the food and other industrial sectors. To this end, this study seeks to identify microorganisms, especially beneficial ones in spontaneous fermented cashew nuts, with the view of recommending them for use in the fermentation of cashew nut milk to produce value-added products. 

Materials

Raw cashew nuts (Brazilian red variety) were obtained from an 8-12-year-old cashew tree from a farm in Ayedun, Kwara State, Nigeria. Cashew nut seeds were properly identified in the Department of Plant Biology, University of Ilorin, with herbarium identification number UILH/001/835/2023. All chemicals and reagents used were of analytical grade and purchased from chemicals and reagents stores in Ilorin, Kwara State, Nigeria.

Cashew Nut Processing

Raw cashew nuts were sun-dried for 14 days at ambient temperature (25 + 5^°C) to relatively low moisture content until ready for use. The method of Olayinka et al. [8] was adopted for cashew nut processing. Raw cashew nuts were sorted and soaked in a 5% NaCl solution overnight. The soaked nuts were washed and steam boiled using a steam boiler (at a pressure of 0.62 Mpa) for 40 min contact time (between steam and cashew nuts). The steamed nuts were cool, shelled using a foot-pedaled shelling machine, and the nut roasted for 40 min.

Cashew Nut Milk Extraction

Cashew nuts (500.0 g) were blended with water (500.0 mL) using a blender (Saisho S-748 Model) to a smooth paste. The resultant paste was sieved using triple-folded cheese cloth to obtain cashew nut milk, which was stored for further use.

Spontaneous Fermentation of Cashew Nut Milk

Cashew nut milk extracted was poured into a plastic container and kept on the laboratory bench for 3 days for spontaneous/natural fermentation to occur before further analysis.

Microbiological Analyses

Preparation of Culture Media for Microbial Analysis

The culture media used were MRS (De Man, Rogosa, and Sharpe) agar for LAB species and nutrient agar for other species. Each culture medium was prepared according to the manufacturer’s specification and sterilized at 121°C for 15 min in an autoclave.

Microbial Count of Spontaneously Fermented Cashew Nut Milk

The cashew nut milk was subjected to microbial counts using the method described by Prescott and Haley [9]. Serial dilutions were made by pipetting 1 ml of spontaneously fermented cashew nut milk sample carefully into 9 ml of sterile distilled water. This suspension was used for further dilutions up to 109 levels. The plate count was carried out by pipetting 1 ml of the two highest dilutions of each sample into triplicate sterile Petri dishes. Fifteen milliliters (15 ml) of sterile media was pour plated. The inoculated plates were swirled gently and allowed to set. The plates were inverted and incubated at 37°C for 24 h. After which the total plate counts were performed.

Isolation, Characterization, Purification, and Identification of Isolates Using Bio-characterization Methods

Nester et al. [10] pure plate method was used for isolation of the microorganisms. 1.0 mL of 3-day spontaneously fermented cashew nut milk was serially diluted to the 7th factor. The diluent from the 7th factor was plated out on MRS agar for LAB species and nutrient agar (NA) for other species. The culture plate was incubated at 37°C for 24 h; distinct colonies of the microorganisms were isolated based on predominance and subcultured to obtain monocultures of each isolate and were stored on appropriate agar slants. Biochemical characterization and identification of bacterial isolates were carried out using standard methods [11, 12]. These methods involved examination of the colonial morphology of the isolates and subjecting them to special microscopic and biochemical tests such as gram reaction, citrate test, indole test, and catalase test, among others. The morphological characteristics included shape, size, pigmentation, surface, and appearance of colonies. The probable identity of the isolates was identified by reference to Bergey's Manual of Systematic Bacteriology [13]. However, pure isolates from NA were identified using biochemical characterization, while isolates obtained from MRS were identified by molecular method.

Gram Stain Reaction

The method described by Harrigan and MacCane [11] was used. This test was carried out to differentiate between gram-positive and gram-negative bacteria species. A heat-fixed smear of an 18-24 h old culture of the test organisms was prepared on clean, grease-free slides and allowed to air dry. The slide was flooded with crystal violet for 60 s, after which it was washed off with tap water. The slide was reflooded with Lugol’s iodine and allowed to sit for 60 s before it was washed off with tap water. The stain was decolorized with 70% acid alcohol and washed off almost immediately. Then, the slide was counterstained with saffranin and allowed to sit for 30 s before being washed off and placed on the straining rack to air-dry prior to microscopy. Red to pink stain color indicated a negative reaction (gram-negative), while blue to purple color indicated a positive reaction (gram-positive).

Catalase Test

This test was performed as described by Harrigan and MacCane [11]. This test identifies the ability of an organism to produce catalase enzymes, which break down hydrogen peroxide to water and oxygen. The test organisms were picked using a sterile wire loop and allowed to come in contact with hydrogen peroxide solution placed on a sterile slide. The production of gas bubbles showed a catalase positive.

Citrate Test

The method of Harrigan and MacCane [11] was used. This test was used to show the ability of an organism to utilize citrate as its sole source of carbon and energy and also ammonium salts as its nitrogen source. Using Simon’s Citrate agar medium, which contains sodium citrates and ammonium radical (NH₄⁺), the test organisms were seeded into freshly prepared and sterilized citrate agar medium in Petri dishes and incubated at 37°C for 24 h. A change in coloration of the citrate medium from green to blue after incubation shows a positive result.

Motility Test

The motility test was carried out according to the test tube stab method as described by Harrigan and MacCane [11]. This test differentiates motile organisms from non-motile species. The test organisms were stabbed into freshly prepared semi-solid nutrient agar medium in sterile test tubes using a sterile inoculating needle and incubated at 37°C for 24 h. The diffusion of the test organisms from the line of stab into the surrounding nutrient medium indicates a positive result.

Indole Test

The method as described by Collins and Lyne [14] was used to carry out the indole test. This test was used to observe the ability of an organism to decompose the amino acid tryptophan to produce indole. The test organisms were grown in 5 ml of peptone water solution and incubated at 37°C for 48 h before about 0.5 ml of Kovac’s reagent was added to the solution in the test tubes and allowed for 5 s. Formation of a red ring at the topmost (upper) part of the test tube showed a positive indole result.

Oxidase Test

This test was used to identify those bacterial species that produce the enzyme cytochrome oxidase. The method of Collins and Lyne [14] was used. In this method, a piece of filter paper was placed inside a sterile Petri dish, and about 2-3 drops of freshly prepared oxidase reagent were added, and a glass rod was used in picking the test organisms and smearing them on the filter paper in the Petri dish. The formation of a blue to purple coloration on the filter paper shows a positive oxidase result.

Urease Test

This test was used to detect the ability of an organism to produce the enzyme urease by breaking down urea to give ammonia and carbon dioxide. The method of Collins and Lyne [14] was employed. The test organisms were seeded into freshly prepared urease agar in sterile Petri dishes and incubated at 37°C for 24 h. A change in coloration of the urease agar medium from orange to pink indicates a positive urease result.

Methyl Red Test (M.R.)

The method reported by Collins and Lyne [14] was also employed. This test is used in the detection of acid production by an organism during the fermentation of carbohydrates. The test organisms were inoculated into test tubes containing D-glucose sugar and peptone water and incubated at 37 °C for 24 h. After incubation, about 5 drops of 0.05% potassium methyl red indicator were added to the culture medium. A bright magenta coloration observed in the medium indicates a positive result, while a yellow coloration of the medium shows a negative reaction.

Voges Proskauer Test

The method described by Harrigan and MacCane [11] was employed. This test was used to detect the fermentation reaction of acetyl-methyl carbonyl from dextrose by an organism. The test organisms were grown in test tubes containing peptone water and incubated at 37°C for 48 h. After incubation, 5 drops of 40% potassium hydroxide were added and shaken, and then 2-5 drops of alpha-naphthol solution were added and allowed to stand for 2-5 min. The production of a pink coloration in the medium shows a positive reaction.

Hydrogen Sulfide Formation Test (H₂S)

The test organism was stabbed 2 cm deep down on a slant of TSI (Triple Sugar Ion) medium to the butt. It was incubated at 37°C for 24 h. The H2S formation was determined by black coloration on the streaked line [15].

Sugar Fermentation Test

This test shows the ability of an organism to utilize different carbohydrates such as sucrose, glucose, fructose, lactose, maltose, galactose, and mannitol with the production of acid and gas. The method of Harrigan and McCane [11] was used. The test organisms were inoculated into sterile test tubes containing peptone water and methyl red indicator and inserted into Durham’s tubes. After inoculation, the test tubes were incubated at 37°C for 24 h and then observed for color change in the media from red to yellow, which shows a positive result, while the presence of gas bubbles in the inverted Durham’s tubes indicates gas production. However, the respective isolates were identified based on the morphological and biochemical tests.

Microbial Identification of Isolates using Bio-Molecular Methods

Molecular biology methods were used to identify the presence of specific microorganisms in the tested material that was grown on MRS. 16S rRNA/16S ribosomal DNA (rDNA) gene sequencing is considered the gold standard in identifying microorganisms.

DNA Extraction and PCR Amplification

Genomic DNA was extracted from bacterial isolates using the DNeasy extraction kit (Qiagen, USA) following the protocol provided by the manufacturer. The 16S rRNA gene of the bacterial isolates was amplified using the bacterial universal primers (27F—AGAGTTTGATCCTGGCTCAG and 1492R—GGTTACCTTGTTACGACTT). Thereafter, nested PCR using 27F and WLAB2R (5’-TCGAATTAAACCACATGCTCCA-3’) was used to amplify the region of the 16S rRNA gene specific for the organisms. The PCR products were visualized on 1.0% agarose gels to confirm the fragment.

DNA Sequencing and Analysis

The amplified gene was sequenced with 518F and 800R primers using the ABI PRISM Big Dye Terminator cycle sequencer (Macrogen, USA). The identity of the isolates was obtained by aligning the gene sequences with the sequences in GenBank using the Basic Local Alignment Search Tool (BLAST) search program at the National Centre for Biotech Information (NCBI).

Microbiological Analysis of Spontaneously Fermented Cashew Nut Milk

Results of the microbial load of cashew nut milk under spontaneous fermented conditions are shown in Table 1. Results indicated high microbial loads in spontaneous fermented cashew nut milk samples. The suspected microorganisms isolated from nutrient agar plates are presented in Table 2. The identified microorganisms were Salmonella spp., Escherichia coli, Klebsiella spp., Streptococcus sp., Staphylococcus aureus, Pseudomonas aeruginosa, Enterobacter sp., Proteus sp., Citrobacter sp., and Bacillus cereus.

Bio-molecular Identification of Bacterial Isolates

The results of nucleotide bases of DNA sequencing for the identification of predominant bacterial isolates are shown in Figures 1-3, while BLAST prediction is presented in Table 3. Results indicated that the similarity index (99.08–99.73%) of predominant isolates was very close to Bacillus cereus, and the identified isolates were Bacillus cereus.  However, the results showed that lactic acid bacteria (LAB) could not grow in/on cashew nut milk under spontaneous fermentation except if it is intentionally added into the medium, because the substrate lacks lactose, which is a major sugar for LAB. This study revealed that Bacillus cereus, despite not being a lactic acid bacterium, can also grow on MRS agar. This finding corroborates with the studies reported by Li et al. [16] and Golnari et al. [17], where Bacillus cereus was isolated from MRS agar.

Table 1: Microbial Load of Spontaneous Fermented Cashew Nut Milk.

Table 2: Morphological and Biochemical Characterization and Identification of Isolates from Spontaneous Fermented Cashew Nut Milk Grown on Nutrient Agar.

Figure 1: DNA Sequence of Sample V1 - Bacillus cereus.

Figure 2: DNA Sequence of Sample V2 - Bacillus cereus.

Figure 3: DNA Sequence of Sample V3 - Bacillus cereus.

Table 3: BLAST Prediction.

This study concluded that spontaneously fermented cashew milk contains higher numbers of bacterial loads. The biochemical characterization and identification revealed the presence of Salmonella spp., Escherichia coli, Klebsiella spp., Streptococcus sp., Staphylococcus aureus, Pseudomonas aeruginosa, Enterobacter sp., Proteus sp., Citrobacter sp., and Bacillus cereus, while molecular identification showed all the isolates on MRS agar as Bacillus cereus with percentage identity as high as 99.73% and as low as 99.08%. This study established that LAB could not grow in/on cashew nut milk under spontaneous conditions except when intentionally added into the medium. 

Declaration

Funding: This research received no external funding.

Conflict of interest/Competing interests: The authors declared no conflict of interest.

Ethics approval: This research received ethical approval from the University of Ilorin Ethical Committee.

1. Nascimento AN, Naozuka J, Oliveira PV. In vitro evaluation of Cu and Fe bioavailability in cashew nuts by off-line coupled SEC-UV and SIMAAS. Microchem J. 2010; 96: 58-63.
2. Marshall E, Mejia D. Traditional fermented food and beverages for improved livelihoods. Food and Agriculture Organization of the United Nations: Rome, Italy. 2012: 1-79.
3. Chaves-Lopez C, Rossi C, Maggio F, Paparella A, Serio A. Changes occurring in spontaneous maize fermentation: An Overview. Fermentation. 2020; 6: 36.
4. N’zi KP, Martial-Didier AK, N’guessan KF, Attchelouwa KC, Kablan T. Effect of spontaneous fermentation time on physicochemical, nutrient, anti-nutrient and microbiological composition of Lima Bean (Phaseolus lunatus) flour. J Appl Biosci. 2021; 162: 16707-16725.
5. Tamang JP, Watanabe K, Holzapfel WH. Review: Diversity of Microorganisms in global fermented foods and beverages. Front Microbiol. 2016; 7.
6. Petruzzi L, Capozzi V, Berbegal C, Corbo MR, Bevilacqua A, Spano G, et al. Microbial resources and enological significance: Opportunities and benefits. Front Microbiol. 2017; 8.
7. Greppi A, Rantsiou K, Padonou W, Hounhouigan J, Jespersen L, Jakobsen M, et al. Determination of yeast diversity in ogi, mawè, gowé and tchoukoutou by using culture-dependent and -independent methods. Int J Food Microbiol. 2013; 165: 84-88.
8. Olayinka J, Eugene Y, Olalekan O, Richard I, Chuka M. Physicochemical, microbiological and sensory characteristics of cashew milk formulated yoghurt. Afr J Food Sci. 2018; 12: 204-209.
9. Prescott LM, Harley PJ. Microbiology. 3rd Edn. Mexico City: McGraw Hill, 1999; 67-204.
10. Nester EW, Robert CE, Nester MT. Microbiology: A Human Perspectives. Oxford, England: Wm. C. Brown Publishers. 1995; 119-200; 727-728.
11. Harrigan WF, McCane ME. Laboratory Methods in Food & Dairy Microbiology. London: Academic Press, 1976; 240-249.
12. Cowan ST. Cowan and Steel’s Manual for the Identification of Medical Bacteria. 3rd Edn. London: Cambridge University Press, 1985; 437-439.
13. Holt JG, Kreig NG, Peter HA, Sneath ST, Williams ST. Bergeys Manual of Systematic Bacteriology. 9th Edn. Baltimore: Lippincott Williams and Wilkins Publisher, 2000; 175-201, 527-528.
14. Collins CH, Lyne PM. Microbiological Methods. 8th Edn. London: Arnold Publishers, 2004; 159-179.
15. Edem VE, Abubakar AW, Etukakpan MN, Elijah AI. Microbial assessment of fura-nunu sold in Eiyenkorin, Kwara State, Nigeria. Int J Nat Sci Res. 2022; 10: 30-42.
16. Li P, Tian W, Jiang Z, Liang Z, Wu X, Du B. Genomic characterization & probiotic potency of Bacillus sp. DU-106, a highly effective producer of L-lactic acid isolated from fermented yoghurt. Front Microbiol. 2018; 9: 2216.
17. Golnari M, Bahrami N, Milanian Z, Khorasgani MR, Asadollahi MA, Shafiei R, et al. Isolation and characterization of novel Bacillus strains with superior probiotic potentials: comparative analysis and safety evaluation. Scientific Reports. 2024; 14: 1457.